Tuesday, March 28, 2006
Home Alone
For the next few days, it's just Yoshi and me at home. Michael went back to Chicago to do work (family business stuff) so I am home alone and will probably spend 5 hours a night reading & searching for new adoption blogs*.
You may have noticed from my profile that I'm a Marketing Manager for a biotech company. It's been a long road to get this position. I went to University of Wisconsin-Madison for my undergraduate degree and graduated in 1994 with a B.S. in Bacteriology. I love this because whenever there is a debate at home about whether we should throw out leftovers - I automatically bring up my degree in order to lift my decision/credibility. After school, I worked in the Veterinary School and did research. I considered going to Vet School, because I love animals, but didn't quite have the grades, drive and focus to do something like that at the time. And I met a guy on vacation in Ireland and ended up moving to Manchester UK to live with him. Over in the UK, I managed a research lab at the University and went to school part-time to get a research degree in gene therapy (I can talk about viruses and brain cancer and a whole bunch of yucky things). It didn't work out with the guy of course (I was in my mid-20s), and I knew I wanted to get back to the US and eventually "settle down", so after four years I packed up and moved back to my hometown, Madison.
I got a job at a biotech company in technical support. By this time, I decided I didn't want to do research, but do something business-related in the science field. I quickly moved into a European sales role (because I lived in the UK, they thought that was a good fit) and then moved into Product Management. After 3 years in Madison, and in the meantime meeting Michael (story for another day) we decided we needed to go somewhere. My company in Madison was acquired by a San Diego-based biotech, and we jumped at the opportunity to do a company transfer (=company-paid relocation, why not?).
I was still a Product Manager when I moved here, and up until three months ago. But last summer, I was needing a change, and also needed some time to figure out the next 20 years. We knew we wanted to adopt, but with work I didn't have time to do the research to figure out how/why/when. So I quit my job. They didn't have a replacement, so I agreed to stay on part-time until they found someone. This turned out well, because I was able to decide on Russia, choose a few agencies of interest, and we found out that we couldn't start the adoption until we had some "married time". My company re-organized, a new position came up which was one step up on the food chain with responsibilities which are more suited to my strengths and the things I like to do. And since I didn't have anything else to do while I was waiting to start waiting (& we decided to buy this BIG house), I went back to work full-time in January.
So what do I do all day? I spend about 9 hours in front of a computer and phone. I work through 80-100 emails per day. (Proudly, I do not check my blogs. I keep my addiction secret at work.) I have a fun job - I work with Product Managers to define their marketing campaign strategies and help them work their projects through the system. I assist with ad & brochure development, direct mail campaigns, eMarketing, and sales training. I take this information (from San Diego, our world headquarters) and push it out to our colleagues in Europe, Asia-Pacific, and other parts of the world. It's a cool job. I get to travel sometimes. I think I'll get to go to Japan, China and Singapore in June to work with our AP marketing folks.
Why did I bring up all of this? Because I love these site tracking tools (*). I have recently discovered that people are finding my blog via MSN and Google and Blogger searches. For a marketing person, it's cool to come up high on a Google organic search page. I don't know why this is happening, but I should figure it out and apply it to my job.
I'm going to go unpack some boxes before American Idol is on. Go Chris!
You may have noticed from my profile that I'm a Marketing Manager for a biotech company. It's been a long road to get this position. I went to University of Wisconsin-Madison for my undergraduate degree and graduated in 1994 with a B.S. in Bacteriology. I love this because whenever there is a debate at home about whether we should throw out leftovers - I automatically bring up my degree in order to lift my decision/credibility. After school, I worked in the Veterinary School and did research. I considered going to Vet School, because I love animals, but didn't quite have the grades, drive and focus to do something like that at the time. And I met a guy on vacation in Ireland and ended up moving to Manchester UK to live with him. Over in the UK, I managed a research lab at the University and went to school part-time to get a research degree in gene therapy (I can talk about viruses and brain cancer and a whole bunch of yucky things). It didn't work out with the guy of course (I was in my mid-20s), and I knew I wanted to get back to the US and eventually "settle down", so after four years I packed up and moved back to my hometown, Madison.
I got a job at a biotech company in technical support. By this time, I decided I didn't want to do research, but do something business-related in the science field. I quickly moved into a European sales role (because I lived in the UK, they thought that was a good fit) and then moved into Product Management. After 3 years in Madison, and in the meantime meeting Michael (story for another day) we decided we needed to go somewhere. My company in Madison was acquired by a San Diego-based biotech, and we jumped at the opportunity to do a company transfer (=company-paid relocation, why not?).
I was still a Product Manager when I moved here, and up until three months ago. But last summer, I was needing a change, and also needed some time to figure out the next 20 years. We knew we wanted to adopt, but with work I didn't have time to do the research to figure out how/why/when. So I quit my job. They didn't have a replacement, so I agreed to stay on part-time until they found someone. This turned out well, because I was able to decide on Russia, choose a few agencies of interest, and we found out that we couldn't start the adoption until we had some "married time". My company re-organized, a new position came up which was one step up on the food chain with responsibilities which are more suited to my strengths and the things I like to do. And since I didn't have anything else to do while I was waiting to start waiting (& we decided to buy this BIG house), I went back to work full-time in January.
So what do I do all day? I spend about 9 hours in front of a computer and phone. I work through 80-100 emails per day. (Proudly, I do not check my blogs. I keep my addiction secret at work.) I have a fun job - I work with Product Managers to define their marketing campaign strategies and help them work their projects through the system. I assist with ad & brochure development, direct mail campaigns, eMarketing, and sales training. I take this information (from San Diego, our world headquarters) and push it out to our colleagues in Europe, Asia-Pacific, and other parts of the world. It's a cool job. I get to travel sometimes. I think I'll get to go to Japan, China and Singapore in June to work with our AP marketing folks.
Why did I bring up all of this? Because I love these site tracking tools (*). I have recently discovered that people are finding my blog via MSN and Google and Blogger searches. For a marketing person, it's cool to come up high on a Google organic search page. I don't know why this is happening, but I should figure it out and apply it to my job.
I'm going to go unpack some boxes before American Idol is on. Go Chris!
4 Comments:
Adopt A Child.orgAdopting from Russia
Eastern European Adoption Coalition, Inc
Embassy of the Russian Federation
Families for Russian and Ukrainian Adoption
Karen's Adoption Links
Older Child Adoption
Russia Adoption Blog
Russian Adoption Medical Services
Russian Family Search
Russian Toys
Vernissage Press
Wow. I have never heard of a Bacteriology degree. How long can I can I keep our leftovers in the fridge before I should toss them?
You sound like you have lived quite an adventurous life. Vacationing and living in Europe. Now you live in a gorgeous home in Southern Cal and have a cool job. Want to trade lives? Ha Ha.
You know a lot about genes huh? Can you tell me if I answered this problem right on my current biology assignment?
This is an mRNA sequence: GAUGGAGUCUAAGCGGAUGGA
a. What is the informational DNA sequence: GATGGAGTCTAAGCGGATGGA
b. What is the antisense DNA sequence that would be found in the template strand for the information sequence that you submitted as an answer for the previous question? CTACCTCAGATTCGCCTACCT
Thanks!
What are these site tracking tools that you are referring to? How do you know people are finding your blog through MSN and Google, etc.?
Sorry so long!
I contracted at a pharmaceutical company for a while and the chemists all acted like everyone else should bow before them.
So, chemistry majors=bad. Bacteriology majors=good.